Strony: [1]
  Drukuj  
Autor Wątek: czynniki transkrypcyjne  (Przeczytany 1029 razy)
maciosz
Administrator
Hero Member
*****
Wiadomości: 725


5564019
Zobacz profil Email
« : Sierpnia 04, 2015, 11:01:30 »

Zadanie jest na razie szkicem, pracuję nad danymi, które nie będą banalne i jeśli ktoś będzie próbował to rozwiązać na papierze to 5 razy się zastanowi czy aby nie lepiej napisać jakiś program który to policzy. (Aczkolwiek wydaje mi się, że nie ma sensu utrudniać go tak, żeby uczynić rozwiązanie na kartce zupełnie niemożliwym, sądzę że takie zadania są jak najbardziej w porządku.)

#Czynniki transkrypcyjne to białka, które umieją rozpoznać konkretną sekwencję w łańcuchu DNA, związać się do niej i wywołać jakąś reakcję, np. spowodować #ekspresję genu znajdującego się w pobliżu tej sekwencji bądź przeciwnie, zahamować ją. Pełnią więc bardzo istotną rolę w regulowaniu ekspresji genów.
--- bardziej szczegółowo opisałam to w zadaniu z chip-seqami, być może byłoby sensownie zdecydować które powinno być wcześniej i wstawić ten opis tam, a w drugim zostawić skrócony; no i oczywiście zapewnić żeby jedno było sugerowane po drugim ---
Każdy czynnik transkrypcyjny  rozpoznaje jakieś konkretne, specyficzne dla niego sekwencje - niektóre tylko jedną, np. ATTATCG, niektóre kilka podobnych do siebie, np. ATTTA, ATTCA i ATTGA. W skrócie sekwencje rozpoznawane przez ten ostatni można zapisać tak: ATT[TCG]A, co oznacza, że rozpoznawana sekwencja musi zaczynać się od ATT, następnie mieć T, C lub G i na końcu A.

Załóżmy, że mamy 4 czynniki transkrypcyjne: Florek, Pszemek, Tola i Helga. Florek rozpoznaje sekwencję A[CGA]TACGG, Pszemek: ACCA[CG]TAC, Tola: CGGCGAC[CGT], a Helga CGCGC[CG]G. Ich działanie jest następujące: jeżeli Florek zwiąże się do sekwencji przed jakimś genem, zwiększa jego ekspresję dwukrotnie (czyli jeśli np. bez Florka ten gen ulegał transkrypcji na RNA, a potem translacji na białko raz na minutę, po związaniu się Florka tuż przed nim będzie ulegał transkrypcji dwa razy na minutę); Pszemek zmniejsza ekspresję 3-krotnie, Tola zwiększa 7-krotnie, a Helga zmniejsza 4-krotnie.

Zauważmy, że niektóre z sekwencji rozpoznawanych przez powyższe czynniki nachodzą na siebie. W związku z tym np. w sekwencji AGTACGGCACCAGTAC mogą się związać dwa czynniki: Florek do sekwencji AGTACGG, a Pszemek do ACCAGTAC, ale w sekwencji TACCAGTACTACGGA może się związać tylko jeden: albo Florek do ACTACGG, albo Pszemek do ACCAGTAC, ponieważ jeśli Florek się zwiąże, zasłoni Pszemkowi sekwencję i ten jej zwyczajnie nie znajdzie, i oczywiście odwrotnie. Tak więc dla pierwszej sekwencji mamy jedną możliwość rozmieszczenia czynników transkrypcyjnych, dla drugiej już dwie. Załóżmy, że czynniki wiążą się losowo w taki sposób, że każdy ich możliwy układ jest jednakowo prawdopodobny, czyli w przypadku drugiej sekwencji z prawdopodobieństwem 1/2 zwiąże się Florek i ekspresja wzrośnie dwukrotnie, i z prawdopodobieństwem 1/2 zwiąże się Pszemek i ekspresja zmniejszy się 3 razy.

Przed pewnym genem znajduje się sekwencja:

AATCGGCGACCGAGAACGACTACGGGCAGCCATTCATTCTCCGTCTACGCGCCGAACGTACGTCCCGGGCATGTCTAACCGGATAAAACGCGGCGATGACGTGAGTTCGCACCACTACATCTAAGCGCGCGGCTGTAACTCCCTCAATGGTCGTCACAATCCGGCGACGCGCCGCGCGACTCGGCGACCACTACAACACGGCGACTACGGCGACCCGCCG

Bez związanych czynników transkrypcyjnych komórka produkuje z tego genu 1 białko w ciągu 5 minut. Jakie jest prawdopodobieństwo, że czynniki zwiążą się tak, że będzie produkowała 1 białko w ciągu ... ?


# zadanie już jest w vincim, ale jako szkic, bo na dwa różne sposoby wychodzi mi różna odpowiedź, to wolę przed opublikowaniem sprawdzić jutro jeszcze raz na spokojnie.
« Ostatnia zmiana: Sierpnia 12, 2015, 11:50:50 wysłane przez maciosz » Zapisane

Chaos zawsze pokonuje porządek, gdyż jest lepiej zorganizowany.
Terry Pratchett
Strony: [1]
  Drukuj  
 
Skocz do:  


SimplePortal 2.3.1 © 2008-2009, SimplePortal